This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Myog'-2A-mCherryNLS-PGK-Puro
(Plasmid #69548)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 69548 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PCR2.1
  • Backbone manufacturer
    Invitrogen
  • Total vector size (bp) 7948
  • Vector type
    Mouse Targeting
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    2A-mCherry-NLS
  • Alt name
    mCherry
  • Species
    Synthetic
  • Insert Size (bp)
    819
  • Tags / Fusion Proteins
    • PVT1-2A "skipping" peptide (N terminal on insert)
    • 2x nuclear localization signal (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BsrGI (not destroyed)
  • 5′ sequencing primer cttccctgctggtctctgac
  • 3′ sequencing primer CACCATCGTGGAACAGTACG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Myogenin 5' homology arm
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    702
  • Mutation
    Silent V205V mutation in myogenin gene to prevent Cas9-generated double-strand break.
  • GenBank ID
    NC_000067.6

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer M13-Rev
  • 3′ sequencing primer AAGCGCATGAACTCCTTGAT
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    Myogenin 3' homology arm
  • Alt name
    Myog
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    675
  • GenBank ID
    NC_000067.6
  • Entrez Gene
    Myog (a.k.a. MYF4, bHLHc3, myo)

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer taggtccctcgaagaggttcacta
  • 3′ sequencing primer caaggcgattaagttgggtaacgccag
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Myog'-2A-mCherryNLS-PGK-Puro was a gift from Charles Gersbach (Addgene plasmid # 69548 ; http://n2t.net/addgene:69548 ; RRID:Addgene_69548)