pBS-L1PA1CH_blast rescue
(Plasmid #69611)

• Purpose: Expresses a blasticidin tagged codon optimized L1PA1 designed to recover inserts
• Depositing Lab: Astrid Roy-Engel
• Publication: pBS-LINE1 plasmids (unpublished)

Backbone

• Vector backbone: pBluescript
• Backbone size w/o insert (bp): 3530
• Total vector size (bp): 11679
• Vector type: Mammalian Expression
• Selectable markers: Blasticidin ; detects retrotransposition not the plasmid

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Any standard E.coli strain should work fine
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: L1PA1
• Alt name: LINE-1 PA1 subfamily
• Alt name: L1HS
• Alt name: L1RP
• Species: H. sapiens (human)
• Insert Size (bp): 8533
• Promoter: CMV
• Tag / Fusion Protein:
  • blast rescue cassette

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: AGGCGTGTACGGTGGGAGGTCTA

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The blast rescue cassette was commercially synthesized and cloned into the EcoRI-NotI sites of L1PA1CHmneo to swap the mneo cassette with the blast rescue cassette sequence