pBS-L1PA13ACHmneo
(Plasmid
#69613)
-
PurposeExpresses a neomycin tagged codon optimized L1PA13A
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69613 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBluescript
- Backbone size w/o insert (bp) 3530
- Total vector size (bp) 11338
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418) ; G418 detects retrotransposition not the plasmid
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsStandard E.coli strains can be used.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameL1PA13A
-
Alt nameLINE-1 PA13A subfamily
-
SpeciesH. sapiens (human)
-
Insert Size (bp)7797
- Promoter CMV
-
Tag
/ Fusion Protein
- mneo retrotransposition cassette
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AGGCGTGTACGGTGGGAGGTCTA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The ORF1 and ORF2 of the codon optimized L1PA13A element were commercially synthetically generated and then cloned into the parental pBS-L1PA1CHmneo by swapping the two ORFs.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBS-L1PA13ACHmneo was a gift from Astrid Roy-Engel (Addgene plasmid # 69613 ; http://n2t.net/addgene:69613 ; RRID:Addgene_69613)