This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

FUW TetO HA-AMPKa1 AS
(Plasmid #69825)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 69825 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    FUW TetO
  • Backbone size w/o insert (bp) 8409
  • Total vector size (bp) 10098
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    5'-AMP-activated protein kinase catalytic subunit alpha-1
  • Alt name
    PRKAA1, AMPK1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1689
  • GenBank ID
    BC037303
  • Entrez Gene
    PRKAA1 (a.k.a. AMPK, AMPKa1)
  • Promoter minimal CMV promoter with tetracycline operator
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstB1 (not destroyed)
  • 3′ cloning site Pac1 (not destroyed)
  • 5′ sequencing primer GTCAGATCGCCTGGAG
  • 3′ sequencing primer GACAACGGGCCACAACTCCTC or CAT AGC GTA AAA GGA GCA ACA TAG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

cDNA is from the Orfeome library (Open Biosystems). Backbone is from Brambrink et al, 2008

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FUW TetO HA-AMPKa1 AS was a gift from Anne Brunet (Addgene plasmid # 69825 ; http://n2t.net/addgene:69825 ; RRID:Addgene_69825)