pEGFP-C3-PLK4 K41M-3xFLAG
(Plasmid
#69838)
-
PurposeThis plasmid encodes kinase dead PLK4 isoform 1 (K41M mutation) with an N-terminal EGFP tag and C-terminal 3xFLAG tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69838 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-C3
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4794
- Total vector size (bp) 7704
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePLK4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2910
-
MutationK41M
-
GenBank IDNM_014264
-
Entrez GenePLK4 (a.k.a. MCCRP2, SAK, STK18)
- Promoter CMV
-
Tags
/ Fusion Proteins
- EGFP (N terminal on insert)
- 3xFLAG tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Hind III (not destroyed)
- 3′ cloning site Hind III (not destroyed)
- 5′ sequencing primer GFP 3' Fw (TTCGTGACCGCCGCCGGGATCA) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
PLK4 contains E830D compared to listed reference sequence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-C3-PLK4 K41M-3xFLAG was a gift from Michel Bornens (Addgene plasmid # 69838 ; http://n2t.net/addgene:69838 ; RRID:Addgene_69838) -
For your References section:
Autophosphorylation of polo-like kinase 4 and its role in centriole duplication. Sillibourne JE, Tack F, Vloemans N, Boeckx A, Thambirajah S, Bonnet P, Ramaekers FC, Bornens M, Grand-Perret T. Mol Biol Cell. 2010 Feb 15;21(4):547-61. doi: 10.1091/mbc.E09-06-0505. Epub 2009 Dec 23. 10.1091/mbc.e09-06-0505 PubMed 20032307