Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGEMHEZFCNGA5
(Plasmid #69861)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 69861 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGEMHE
  • Backbone manufacturer
    unknown
  • Backbone size w/o insert (bp) 3022
  • Vector type
    Xenopus oocyte expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ZFCNGA5
  • Alt name
    CNGA5
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    2022
  • Mutation
    none
  • Entrez Gene
    cnga5
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XmaI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer T7 forward
  • 3′ sequencing primer pGEMHE/R1 GTAGCTTAGAGACTCCATTCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note: This plasmid has an S132P amino acid residue substitution introduced via PCR, but this residue change is not thought to have any effect on ZFCNGA5 physiology or function

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEMHEZFCNGA5 was a gift from Gary Matthews (Addgene plasmid # 69861 ; http://n2t.net/addgene:69861 ; RRID:Addgene_69861)
  • For your References section:

    Characterization of a novel cyclic nucleotide-gated channel from zebrafish brain. Tetreault ML, Henry D, Horrigan DM, Matthews G, Zimmerman AL. Biochem Biophys Res Commun. 2006 Sep 22;348(2):441-9. Epub 2006 Jul 28. 10.1016/j.bbrc.2006.07.074 PubMed 16887101