Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLKO_HOXB13_#1
(Plasmid #70093)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 70093 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLKO.1
  • Backbone manufacturer
    Broad Institute
  • Backbone size w/o insert (bp) 7000
  • Total vector size (bp) 7000
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    HOXB13
  • gRNA/shRNA sequence
    CCCGTGCCTTATGGTTACTTT
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_006361.5
  • Entrez Gene
    HOXB13 (a.k.a. HPC9, PSGD)
  • Promoter U6

Cloning Information

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Broad Institute

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Broad Institute Clone ID TRCN0000020845

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO_HOXB13_#1 was a gift from William Hahn (Addgene plasmid # 70093 ; http://n2t.net/addgene:70093 ; RRID:Addgene_70093)
  • For your References section:

    The androgen receptor cistrome is extensively reprogrammed in human prostate tumorigenesis. Pomerantz MM, Li F, Takeda DY, Lenci R, Chonkar A, Chabot M, Cejas P, Vazquez F, Cook J, Shivdasani RA, Bowden M, Lis R, Hahn WC, Kantoff PW, Brown M, Loda M, Long HW, Freedman ML. Nat Genet. 2015 Nov;47(11):1346-51. doi: 10.1038/ng.3419. Epub 2015 Oct 12. 10.1038/ng.3419 PubMed 26457646