pAG4
(Plasmid
#70115)
-
Purpose(Empty Backbone) Tn7-based lux reporter for promoter cloning in bacteria
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 70115 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC18
-
Modifications to backboneModified from pUC18-mini-Tn7T-Gm-lux (AY962893.1) with deletions of nt 1053-1113 and 2042-2503.
-
Vector typeBacterial Expression
- Promoter none
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer pCR8_R1 cgaaccgaacaggcttatgt (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byH. Schweizer
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
See J. Microbio. Methods 2015 118:75-79 for details
The authors used this vector along with a Tn7 transposase encoding plasmid, pTNS1.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAG4 was a gift from Thomas Lewis (Addgene plasmid # 70115 ; http://n2t.net/addgene:70115 ; RRID:Addgene_70115) -
For your References section:
An improved Tn7-lux reporter for broad host range, chromosomally-integrated promoter fusions in Gram-negative bacteria. Glassing A, Lewis TA. J Microbiol Methods. 2015 Sep 1;118:75-77. doi: 10.1016/j.mimet.2015.08.016. 10.1016/j.mimet.2015.08.016 PubMed 26341612
Map uploaded by the depositor.