FUCas9Cherry
(Plasmid #70182)

• Purpose: Expresses Cas9 with fluorescent Cherry reporter
• Depositing Lab: Marco Herold
• Publication: Aubrey et al Cell Rep. 2015 Mar 3;10(8):1422-32. doi: 10.1016/j.celrep.2015.02.002. Epub 2015 Feb 26.

Backbone

• Vector backbone: FUGW
• Backbone manufacturer: David Baltimore
• Modifications to backbone: FUGW was modified by replacing EGFP coding sequence with Cas9_T2AmCherry
• Vector type: Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: humanised S.pyogenes cas9
• Species: S.pyogenes
• Insert Size (bp): 4290
• Promoter: hUbC
• Tag / Fusion Protein:
  • 3xFLAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoR1 (not destroyed)
• 3′ cloning site: BamH1 (destroyed during cloning)
• 5′ sequencing primer: ggcgagtgtgttttgtgaag

Resource Information

• Articles Citing this Plasmid:
  • 30 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry