Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pACUH-GFP11x7-mCherry-α-tubulin
(Plasmid #70218)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 70218 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pACUH
  • Backbone manufacturer
    Yuh-Nung Jan lab
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP11x7-mCherry-α-tubulin
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    2538
  • Tags / Fusion Proteins
    • GFP11x7 (N terminal on insert)
    • mCherry (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TCAACTGCAACTACTGA
  • 3′ sequencing primer GCTTTAAATCTCTGTAGGTAGTTTGTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pACUH-GFP11x7-mCherry-α-tubulin was a gift from Bo Huang (Addgene plasmid # 70218 ; http://n2t.net/addgene:70218 ; RRID:Addgene_70218)
  • For your References section:

    Versatile protein tagging in cells with split fluorescent protein. Kamiyama D, Sekine S, Barsi-Rhyne B, Hu J, Chen B, Gilbert LA, Ishikawa H, Leonetti MD, Marshall WF, Weissman JS, Huang B. Nat Commun. 2016 Mar 18;7:11046. doi: 10.1038/ncomms11046. 10.1038/ncomms11046 PubMed 26988139