-
PurposeTagRFP-T^SEC^3xMyc vector with ccdB sites for cloning homology arms.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 70684 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC19 (modified)
- Backbone size w/o insert (bp) 2600
- Total vector size (bp) 10500
-
Modifications to backboneAddition of ccdB markers to facilitate homology arm cloning
-
Vector typeWorm Expression, Cre/Lox, CRISPR
-
Selectable markersHygromycin ; sqt-1(d) (worm phenotypic marker)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Turbo
-
Growth instructionsThe dual ccdB sites in this vector may make it prone to recombination. It is recommended to pick several single clones and check test by restriction digestion before use. This construct should be maintained as a purified plasmid stock in addition to a bacterial stock in case there is a need to re-transform.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTagRFP-T-C1^SEC^3xFlag
-
SpeciesC. elegans (nematode), Synthetic
-
Insert Size (bp)6600
-
Tags
/ Fusion Proteins
- C. elegans codon-optimized TagRFP-T
- 3xMyc
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer M13 Forward (tgtaaaacgacggccagt)
- 3′ sequencing primer M13 Reverse (caggaaacagctatgaccatg) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pDD286 is a derivative of our published TagRFP-SEC vector pDD284 (Dickinson et al. Genetics 2015, Addgene plasmid number 66825). It has a 3xMyc tag in place of 3xFlag, and Lox2272 sites in place of LoxP. These features allow pDD286 to be used in a genetic background that has already been modified using a green FP-SEC vector, without conflicts between epitope tags and Lox sites.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDD286 (TagRFP^SEC^3xMyc) was a gift from Bob Goldstein (Addgene plasmid # 70684 ; http://n2t.net/addgene:70684 ; RRID:Addgene_70684)