pTRIPZ-hDDX5/17
(Plasmid #71307)

• Purpose: Inducible shRNA knockdown of both human DDX5 and DDX17 genes
• Depositing Lab: Allan Brasier
• Publication: Yang et al Mol Cell Proteomics. 2015 Oct;14(10):2701-21. doi: 10.1074/mcp.M115.049221. Epub 2015 Jul 24.

Backbone

• Vector backbone: pTRIPZ
• Backbone manufacturer: GE - Dharmacon
• Backbone size w/o insert (bp): 13362
• Total vector size (bp): 13406
• Vector type: Mammalian Expression, Lentiviral, RNAi
• Selectable markers: Puromycin, Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: DDX5/17 shRNA
• gRNA/shRNA sequence: AGGGCTAGATGTGGAAGATGT
• Species: H. sapiens (human)
• GenBank ID: NM_004396 NM_001098504, NM_006386
• Entrez Gene: DDX17 (a.k.a. P72, RH70)
• Promoter: TetO

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: 5’-GGAAAGAATCAAGGAGG-3’
• 3′ sequencing primer: 5'-TCTGACGTGGCAGCGCTCGCC-3'

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry