Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGC629
(Plasmid #71364)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 71364 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pNL205
  • Backbone manufacturer
    Libina, et al. 2003. PMID 14622602
  • Total vector size (bp) 13565
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    daf-16
  • Species
    C. elegans (nematode)
  • Entrez Gene
    daf-16 (a.k.a. CELE_R13H8.1)
  • Promoter fos1a promoter
  • Tag / Fusion Protein
    • GFP(65C) (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GFP-F (GGTCCTTCTTGAGTTTGTAAC)
  • 3′ sequencing primer T7
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    fos1a promoter was PCR amplified from pBSfos-1p (a kind gift from David Sherwood).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGC629 was a gift from Jane Hubbard (Addgene plasmid # 71364 ; http://n2t.net/addgene:71364 ; RRID:Addgene_71364)
  • For your References section:

    Non-autonomous DAF-16/FOXO activity antagonizes age-related loss of C. elegans germline stem/progenitor cells. Qin Z, Hubbard EJ. Nat Commun. 2015 May 11;6:7107. doi: 10.1038/ncomms8107. 10.1038/ncomms8107 PubMed 25960195