pKM343
(Plasmid #71487)

• Purpose: Contains loxP-hyg-cat-loxP cassette for recombineering; CamR, HygR.
• Depositing Lab: Kenan Murphy
• Publication: Murphy et al Methods Mol Biol. 2015;1285:177-99. doi: 10.1007/978-1-4939-2450-9_10.

Backbone

• Vector backbone: pJM1
• Backbone manufacturer: Jeffery Murry - Eric Rubin Lab
• Total vector size (bp): 5255
• Modifications to backbone: Base pair in pJM1 at position 2008 was changed from G to C to remove a stop codon following the second loxP site.
• Vector type: Bacterial Expression ; Source of loxP-hyg-cat- loxP for PCR amplification.
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Select with 20 ug/ml chloramphenicol
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: loxP-hyg-cat-loxP
• Insert Size (bp): 1985

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CGCTCTAGAACTAGTGGATCC
• 3′ sequencing primer: GCCATTGGGATATATCAACGGTGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Jeffery Murry

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This vector contains a hyg-cat cassette, flanked by loxP sites, that can be used for the construction of recombineeng substrates for M. smegmatis or M. tuberculosis. It contains a 1 bp change (relative to starting plasmid pJM1) at position 2008 (G to C) that eliminate a potential stop codon that could interfere with expression of downstream functions following excision of the cassette from the chromosome by Cre recombinase.

The hygromycin resistance gene encodes M13I and I111T variants compared to the NCBI reference [ADL66925.1]. These variants should not interfere with function.