This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pSS9
(Plasmid #71655)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 71655 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBR322
  • Backbone manufacturer
    New England Biolabs
  • Backbone size w/o insert (bp) 4751
  • Total vector size (bp) 5662
  • Modifications to backbone
    Backbone has 600 bp homology arms for integration into SS9. The upstream (5') homology contains a PAM mutation to inactive SS9_gRNA cleavage.
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gfpuv
  • Species
    Synthetic; Cloning vector pGFPuv
  • Insert Size (bp)
    911
  • GenBank ID
    U62636.1
  • Promoter T7A1

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AGTGACAAAAATAAATTATTTATTTATCCAGAAAATGAATTGGAAAATC
  • 3′ sequencing primer CACATACTTATTATGAATGATAAAATTCATTCAATTAATAACAC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSS9 was a gift from Ryan Gill (Addgene plasmid # 71655 ; http://n2t.net/addgene:71655 ; RRID:Addgene_71655)
  • For your References section:

    Rapid and Efficient One-Step Metabolic Pathway Integration in E. coli. Bassalo MC, Garst AD, Halweg-Edwards AL, Grau WC, Domaille DW, Mutalik VK, Arkin AP, Gill RT. ACS Synth Biol. 2016 Apr 22. 10.1021/acssynbio.5b00187 PubMed 27072506