-
PurposeLentiviral expression of HIF2A-GFP
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 71708 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCDH
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHIF2A
-
Alt nameEPAS1
-
SpeciesH. sapiens (human)
-
Entrez GeneEPAS1 (a.k.a. ECYT4, HIF2A, HLF, MOP2, PASD2, bHLHe73)
-
Tags
/ Fusion Proteins
- HA (N terminal on insert)
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer pcDL-F (GTTGCCTTTACTTCTAGGCCT)
- 3′ sequencing primer EGFP-N (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH-CB1-HIF2a-GFP-T2A-Puro was a gift from Eric Jonasch & Xiande Liu (Addgene plasmid # 71708 ; http://n2t.net/addgene:71708 ; RRID:Addgene_71708) -
For your References section:
Autophagy mediates HIF2alpha degradation and suppresses renal tumorigenesis. Liu XD, Yao J, Tripathi DN, Ding Z, Xu Y, Sun M, Zhang J, Bai S, German P, Hoang A, Zhou L, Jonasch D, Zhang X, Conti CJ, Efstathiou E, Tannir NM, Eissa NT, Mills GB, Walker CL, Jonasch E. Oncogene. 2015 May 7;34(19):2450-60. doi: 10.1038/onc.2014.199. Epub 2014 Jul 7. 10.1038/onc.2014.199 PubMed 24998849