pRK5-H1-shRNA-CMV-HA-PACSIN1
(Plasmid
#72577)
-
PurposeBicistronic construct expressing PACSIN1 shRNA and HA-PACSIN1-rescue construct
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 72577 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRK5
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 6588
-
Vector typeMammalian Expression, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namePACSIN1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1326
-
Mutation5 silent mutations around shRNA recognition sequence
-
Entrez GenePacsin1 (a.k.a. A830061D09Rik, H74, mKIAA1379, syndapin)
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (N terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ggtgacactatagaataacatccac
- 3′ sequencing primer cccgatcgatccagacatgataag (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameH1-PACSIN1 shRNA cassette
-
Insert Size (bp)300
- Promoter H1
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site PciI (not destroyed)
- 3′ cloning site PciI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TTAACCCTCACTAAAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRK5-H1-shRNA-CMV-HA-PACSIN1 was a gift from Richard Huganir (Addgene plasmid # 72577 ; http://n2t.net/addgene:72577 ; RRID:Addgene_72577) -
For your References section:
PICK1 interacts with PACSIN to regulate AMPA receptor internalization and cerebellar long-term depression. Anggono V, Koc-Schmitz Y, Widagdo J, Kormann J, Quan A, Chen CM, Robinson PJ, Choi SY, Linden DJ, Plomann M, Huganir RL. Proc Natl Acad Sci U S A. 2013 Aug 20;110(34):13976-81. doi: 10.1073/pnas.1312467110. Epub 2013 Aug 5. 10.1073/pnas.1312467110 PubMed 23918399