pET21-Drp1
(Plasmid #72927)

• Purpose: Bacterial expression of mouse Drp1 isoform b (699amino acids) with C-terminal His-tag and PreScission protease cleavage site
• Depositing Lab: David Chan
• Publication: Liu et al Mol Biol Cell. 2015 Dec 1;26(24):4466-77. doi: 10.1091/mbc.E15-08-0591. Epub 2015 Oct 7.

Backbone

• Vector backbone: pET21b(+)
• Backbone manufacturer: EMD Millipore (Novagen)
• Modifications to backbone: PreScission protease site inserted via BamHI/HindIII sites
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Drp1
• Alt name: Dynamin-related protein 1
• Alt name: DNM1L
• Alt name: DLP1
• Species: M. musculus (mouse)
• GenBank ID: NM_001025947.2
• Entrez Gene: Dnm1l (a.k.a. 6330417M19Rik, Dlp1, Dnmlp1, Drp1, python)
• Promoter: T7
• Tags / Fusion Proteins:
  • PreScission Protease site (C terminal on backbone)
  • 6xHis-tag (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: CTAGTTATTGCTCAGCGGTG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry