pLZRS-IRES-deltaNGFR
(Plasmid
#72930)
-
Purpose(Empty Backbone) retroviral expression with FACS-selectable marker (extracellular part of NGFR)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 72930 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLZRS-IRES-deltaNGFR
-
Backbone manufacturerRoel de Paus
- Backbone size (bp) 12878
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer gcccacgtgaaggctgccgacc
- 3′ sequencing primer acgttaggggggggggagggagag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Extracellular domain of NGFR is expressed in tandem with the insert, thus allowing FACS selection of cells retrovirally expressing the insert.
Discrepancies between the full and QC sequence should not have any functional consequence.
This plasmid has been found to be somewhat unstable and prone to recombination. You may need to screen multiple colonies to isolate the full-length, monomeric version of this plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLZRS-IRES-deltaNGFR was a gift from Esther van de Vosse (Addgene plasmid # 72930 ; http://n2t.net/addgene:72930 ; RRID:Addgene_72930) -
For your References section:
Antisense-mediated exon skipping to correct IL-12Rbeta1 deficiency in T cells. van_de_Vosse E, Verhard EM, de Paus RA, Platenburg GJ, van Deutekom JC, Aartsma-Rus A, van Dissel JT. Blood. 2009 May 7;113(19):4548-55. doi: 10.1182/blood-2008-12-196220. Epub 2009 Mar 3. 10.1182/blood-2008-12-196220 PubMed 19258592