pET28-Mff(1-61)-PP-GST
(Plasmid
#73042)
-
PurposeBacterial expression of mouse Mff residues 1-61 with C-terminal GST-tag and PreScission protease cleavage site
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73042 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET28a(+)
-
Backbone manufacturerEMD Millipore (Novagen)
-
Modifications to backboneA pET21b promoter (BglII/BamHI), followed by a PreScission protease site (BamHI/HindIII) and the GST sequence from pGEX6P1 (NotI/XhoI, Amersham) replaces the region between BglII/XhoI of pET28a(+)
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameMff(1-61)
-
Alt namemitochondrial fission factor
-
SpeciesM. musculus (mouse)
-
MutationTruncation containing amino acids 1-61
-
Entrez GeneMff (a.k.a. 5230400G24Rik)
- Promoter T7
-
Tags
/ Fusion Proteins
- PreScission protease site (C terminal on backbone)
- GST-tag (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer CTAGTTATTGCTCAGCGGTG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28-Mff(1-61)-PP-GST was a gift from David Chan (Addgene plasmid # 73042 ; http://n2t.net/addgene:73042 ; RRID:Addgene_73042) -
For your References section:
The mitochondrial fission receptor Mff selectively recruits oligomerized Drp1. Liu R, Chan DC. Mol Biol Cell. 2015 Dec 1;26(24):4466-77. doi: 10.1091/mbc.E15-08-0591. Epub 2015 Oct 7. 10.1091/mbc.E15-08-0591 PubMed 26446846