pCAG mFoxg1-GFP T271E
(Plasmid
#73057)
-
PurposeC-terminal GFP fusion of Mouse Foxg1 T271E
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73057 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAG
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFoxg1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)6965
-
MutationT271E
-
Entrez GeneFoxg1 (a.k.a. 2900064B05Rik, BF-1, Bf1, Hfh9, Hfhbf1)
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GTGACCGGCGGCTCTAGAGCCTCTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG mFoxg1-GFP T271E was a gift from Joseph Gleeson (Addgene plasmid # 73057 ; http://n2t.net/addgene:73057 ; RRID:Addgene_73057) -
For your References section:
An AKT3-FOXG1-reelin network underlies defective migration in human focal malformations of cortical development. Baek ST, Copeland B, Yun EJ, Kwon SK, Guemez-Gamboa A, Schaffer AE, Kim S, Kang HC, Song S, Mathern GW, Gleeson JG. Nat Med. 2015 Dec;21(12):1445-54. doi: 10.1038/nm.3982. Epub 2015 Nov 2. 10.1038/nm.3982 PubMed 26523971