pMD19T-slr0168-Ptrc-GFP3mut-CmR
(Plasmid
#73222)
-
PurposeContains GFPmut3b under the Ptrc promoter. Suicide vector inserts into slr0168 site of Synechocystis. Carries chloramphenicol resistance. Propogates in E. coli
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73222 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMD19T simple
-
Backbone manufacturerTakara
- Total vector size (bp) 5628
-
Modifications to backboneHas 2 slr0168 homology regions flanking insert
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFPmut3b
-
Insert Size (bp)720
- Promoter Ptrc
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (destroyed during cloning)
- 3′ cloning site SpeI (destroyed during cloning)
- 5′ sequencing primer CGGGGTTCAGGACAGCTATGAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMD19T-slr0168-Ptrc-GFP3mut-CmR was a gift from Paul Hudson (Addgene plasmid # 73222 ; http://n2t.net/addgene:73222 ; RRID:Addgene_73222) -
For your References section:
Multiple Gene Repression in Cyanobacteria Using CRISPRi. Yao L, Cengic I, Anfelt J, Hudson EP. ACS Synth Biol. 2015 Dec 28. 10.1021/acssynbio.5b00264 PubMed 26689101
Map uploaded by the depositor.
