This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pMD19T-slr0230-PL22-sgRNANT1-KmR
(Plasmid #73224)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 73224 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMD19T simple
  • Backbone manufacturer
    Takara
  • Total vector size (bp) 6094
  • Modifications to backbone
    Has 2 slr2030 homology regions flanking insert
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PL22-sgRNA NT1
  • gRNA/shRNA sequence
    ACCATCTAATTCAACAAGAATT
  • Promoter PL22

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site E.coRI (not destroyed)
  • 3′ cloning site SpeI (destroyed during cloning)
  • 5′ sequencing primer GCAACGGGGTAGGGTCTATC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMD19T-slr0230-PL22-sgRNANT1-KmR was a gift from Paul Hudson (Addgene plasmid # 73224 ; http://n2t.net/addgene:73224 ; RRID:Addgene_73224)
  • For your References section:

    Multiple Gene Repression in Cyanobacteria Using CRISPRi. Yao L, Cengic I, Anfelt J, Hudson EP. ACS Synth Biol. 2015 Dec 28. 10.1021/acssynbio.5b00264 PubMed 26689101