Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

GDAP2
(Plasmid #73259)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 73259 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pFB-LIC-Bse
  • Backbone manufacturer
    SGC, Addgene Plasmid #26108
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    NM_001135589.2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    803
  • Entrez Gene
    GDAP2 (a.k.a. MACROD3, SCAR27)
  • Promoter Polyhedrin
  • Tag / Fusion Protein
    • His-6-TEV (N terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer fBac-1 (tattcataccgtcccacca)
  • 3′ sequencing primer fBac-2 (gggaggttttttaaagcaagtaaa)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Use SF9 for protein expression. See also 4UML: http://www.thesgc.org/structures/4UML

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GDAP2 was a gift from Nicola Burgess-Brown (Addgene plasmid # 73259 ; http://n2t.net/addgene:73259 ; RRID:Addgene_73259)