Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

JH05
(Plasmid #73516)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 73516 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    modified pCFJ150
  • Total vector size (bp) 9601

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    pmex-5::mPYet::PH::tbb-2
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    9601
  • Promoter mex-5
  • Tag / Fusion Protein
    • mYPet (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GATTTTCCGTTTTCTCATTGTATTCTCTC
  • 3′ sequencing primer GAGGAGTTGGGATCCCTTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Gene was synthesized by IDT

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    JH05 was a gift from Bob Goldstein (Addgene plasmid # 73516 ; http://n2t.net/addgene:73516 ; RRID:Addgene_73516)
  • For your References section:

    Comparative assessment of fluorescent proteins for in vivo imaging in an animal model system. Heppert JK, Dickinson DJ, Pani AM, Higgins CD, Steward A, Ahringer J, Kuhn JR, Goldstein B. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394. doi: 10.1091/mbc.E16-01-0063. Epub 2016 Jul 6. 10.1091/mbc.E16-01-0063 PubMed 27385332