pX330-sgRNA_Dgcr8_2
(Plasmid
#73526)
-
PurposeExpresses a human codon-optimized SpCas9 and sgRNA targeting Dgcr8
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73526 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneX330-U6-Chimeric_BB-CBh-hSpCas9
-
Backbone manufacturerFeng Zhang (Addgene plasmid # 42230)
- Backbone size w/o insert (bp) 8506
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDGCR8
-
gRNA/shRNA sequenceCGCATAGACCCGAACTGTA
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)19
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer agggatggttggttggtggg
- 3′ sequencing primer CCAATCCTCCCCCTTGCTGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-sgRNA_Dgcr8_2 was a gift from Constance Ciaudo (Addgene plasmid # 73526 ; http://n2t.net/addgene:73526 ; RRID:Addgene_73526) -
For your References section:
Noncanonical function of DGCR8 controls mESC exit from pluripotency. Cirera-Salinas D, Yu J, Bodak M, Ngondo RP, Herbert KM, Ciaudo C. J Cell Biol. 2017 Jan 18. pii: jcb.201606073. doi: 10.1083/jcb.201606073. 10.1083/jcb.201606073 PubMed 28100686