shNTC
(Plasmid
#73549)
-
PurposeNon-targeting control shRNA cloned in retroviral vector pMLP (MSCV-based vector expressing shRNA in a mir30 context).
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73549 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMLP
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshNTC
-
gRNA/shRNA sequenceshNTC
-
SpeciesH. sapiens (human)
- Promoter LTR
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer cccttgaacctcctcGttcgac
- 3′ sequencing primer CTTCGCGCCACCTTCTACTCCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
shNTC was a gift from Gerardo Ferbeyre (Addgene plasmid # 73549 ; http://n2t.net/addgene:73549 ; RRID:Addgene_73549) -
For your References section:
A CDK4/6-Dependent Epigenetic Mechanism Protects Cancer Cells from PML-induced Senescence. Acevedo M, Vernier M, Mignacca L, Lessard F, Huot G, Moiseeva O, Bourdeau V, Ferbeyre G. Cancer Res. 2016 Jun 1;76(11):3252-64. doi: 10.1158/0008-5472.CAN-15-2347. Epub 2016 Mar 29. 10.1158/0008-5472.CAN-15-2347 PubMed 27206849