-
PurposeGenome editing for gene pyrE (CAC-002) in Clostridium acetobutylicum ATCC 824
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 73639 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $65 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepIMP1-ptb
- Backbone size w/o insert (bp) 4806
-
Vector typeE.coli-clostridium shuttle vector
-
Selectable markersErythromycin in clostridium
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameCas9 nickase
-
SpeciesS. pygogenes
-
MutationD10A
- Promoter ptb
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer SpCas9N-R TACGAGCTGTCCGTTTGAGA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namesGRNA to pyrE
- Promoter j23119
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer unknown (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Terms and Licenses
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNICKclos1.0 was a gift from Sheng Yang (Addgene plasmid # 73639 ; http://n2t.net/addgene:73639 ; RRID:Addgene_73639) -
For your References section:
CRISPR-based genome editing and expression control systems in Clostridium acetobutylicum and Clostridium beijerinckii. Li Q, Chen J, Minton NP, Zhang Y, Wen Z, Liu J, Yang H, Zeng Z, Ren X, Yang J, Gu Y, Jiang W, Jiang Y, Yang S. Biotechnol J. 2016 May 23. doi: 10.1002/biot.201600053. 10.1002/biot.201600053 PubMed 27213844