pS2-FLAG-Sestrin2-L261A
(Plasmid
#73678)
-
Purposeoverexpression
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73678 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepS2
- Backbone size w/o insert (bp) 8000
- Total vector size (bp) 9443
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSesn2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1443
-
MutationL261A changed Leucine 261 to Alanine
-
GenBank IDNM_031459.4 CDS
-
Entrez GeneSESN2 (a.k.a. HI95, SES2, SEST2)
- Promoter Sesn2
-
Tag
/ Fusion Protein
- FLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Age1 (unknown if destroyed)
- 3′ cloning site EcoR1 (unknown if destroyed)
- 5′ sequencing primer CCCGAGGCCAGGGGGAGCAG
- 3′ sequencing primer TAG TTT GTA TGT CTG TTG CTA TTA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pS2-FLAG-Sestrin2-L261A was a gift from David Sabatini (Addgene plasmid # 73678 ; http://n2t.net/addgene:73678 ; RRID:Addgene_73678) -
For your References section:
Sestrin2 is a leucine sensor for the mTORC1 pathway. Wolfson RL, Chantranupong L, Saxton RA, Shen K, Scaria SM, Cantor JR, Sabatini DM. Science. 2016 Jan 1;351(6268):43-8. doi: 10.1126/science.aab2674. Epub 2015 Oct 8. 10.1126/science.aab2674 PubMed 26449471