Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMLS338
(Plasmid #73719)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 73719 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMLS256
  • Vector type
    Worm Expression, Cre/Lox, CRISPR
  • Selectable markers
    Cbr-unc-119

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Unc-32::GFP(Cbr-unc-119)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

2nd Insert: pU6::Unc-32 sgRNA; oMLS471: 5' - TCCAAGAACTCGTACAAAAATGCTC

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMLS338 was a gift from Erik Jorgensen (Addgene plasmid # 73719 ; http://n2t.net/addgene:73719 ; RRID:Addgene_73719)
  • For your References section:

    SapTrap, a Toolkit for High-Throughput CRISPR/Cas9 Gene Modification in Caenorhabditis elegans. Schwartz ML, Jorgensen EM. Genetics. 2016 Feb 2. pii: genetics.115.184275. 10.1534/genetics.115.184275 PubMed 26837755