pZY101
(Plasmid #73932)

• Purpose: This binary vector, also named PTF101, is used as a standard plant transformation vector. For more information, please see http://plantsci.missouri.edu/muptcf/pzy101.html
• Depositing Lab: Zhanyuan Zhang
• Publication: Zeng et al Plant Cell Rep. 2004 Feb;22(7):478-82. Epub 2003 Sep 30.

Backbone

• Vector backbone: pPZP201
• Backbone size w/o insert (bp): 7132
• Total vector size (bp): 8838
• Modifications to backbone: bar gene and hpRNA expression cassettes were inserted.
• Vector type: Plant Expression
• Selectable markers: Basta ; bar

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Growth condition for Agrobacterium carrying this plasmid is at 28 C. SmR gene confers resistance to spectinomycin and streptomycin in bacteria
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: bar
• Alt name: PAT
• Species: Synthetic
• Insert Size (bp): 567
• Promoter: 35S

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xho (not destroyed)
• 3′ cloning site: Hind III (not destroyed)
• 5′ sequencing primer: GAAACCTCCTCGGATTCCAT
• 3′ sequencing primer: CAGCAGGTGGGTGTAGAGCGT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This vector is suitable hpRNA-mediated gene silencing in tissue (seed) specific manner.

Please see the Plant Transformation Core Facility website for more information on using this plasmid: http://plantsci.missouri.edu/muptcf/pzy101.html

The vector has following features:

1. It has two replicate origins that allow to replicate in both E. coli and Agrobacterium tumefaciens cells (at higher copy numbers).
2. It also has bom site that allows you to use tri-parental mating to mobilize the vector to Agrobacterium cells.
3. The aadA locus confers Spectinomycin (100 mg/L) or streptomycin (100 mg/L) resistance and thus enable to use either or both of these two antibiotics for the vector selection.
4. The multiple cloning site (MCS) adjacent to the double CaMV35S promoter will allow you to insert your cassette. This CaMV35S promoter is used to drive the bar ORF and, therefore, is not used in front to drive your gene of interest. You need to assemble your own expression cassette including promoter, gene coding sequence, and terminator, and then insert to anywhere between Hind III and EcoR I within the MCS.

Special notes:

1. Insert your gene expression cassette in such a way that your promoter is adjacent to the promoter driving the bar gene selectable marker. This is to prevent transcription read-through from your gene expression cassette.
2. In order to use the EcoR I site within the MCS, a minimal ratio of this enzyme versus DNA is recommended to avoid star activity. When HindIII and EcoRI are in combined use, even less of each enzyme is required, and reaction should be conducted in a large volume to avoid excessive enzymatic activity.