pZY102
(Plasmid #73933)

• Purpose: This plasmid was derived from pZY101 by inserting a GUS-intron reporter gene cassette into multiple cloning sites. This plasmid is recommended for use as empty control for service event request.
• Depositing Lab: Zhanyuan Zhang
• Publication: Zeng et al Plant Cell Rep. 2004 Feb;22(7):478-82. Epub 2003 Sep 30.

Backbone

• Vector backbone: pPZP201
• Backbone size w/o insert (bp): 7132
• Total vector size (bp): 11605
• Modifications to backbone: bar gene cassette was inserted into multiple cloning site adjacent to T-DNA left border.
• Vector type: Plant Expression
• Selectable markers: Basta ; bar

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: For growing Agrobacterium, 28 C is needed and the same antibiotics selection are needed for selecting the vector. SmR gene confers resistance to spectinomycin and streptomycin in bacteria
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: bar
• Alt name: PAT
• Species: Synthetic
• Insert Size (bp): 567
• Promoter: 35S

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xho I (not destroyed)
• 3′ cloning site: Hind III (not destroyed)
• 5′ sequencing primer: GAAACCTCCTCGGATTCCAT
• 3′ sequencing primer: CAGCAGGTGGGTGTAGAGCGT

Gene/Insert 2

• Gene/Insert name: GUS
• Alt name: beta-glucuronidase
• Species: Synthetic
• Insert Size (bp): 3000
• Mutation: intron is inserted into the GUS coding region
• Promoter: 35S

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: Hind III (not destroyed)
• 3′ cloning site: Hind III (not destroyed)
• 5′ sequencing primer: CGTCCTGTAGAAAACCCAACC
• 3′ sequencing primer: TCATTGTTTGCCTCCCTGCTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This vector is suitable for plant transformation and has been used as standard service empty vector control.