pMU103
(Plasmid #73934)

• Purpose: This is hpRNA construct for gene silencing in soybean seeds. Soybean seed specific promoter, Glycinin gene promoter, is used.
• Depositing Lab: Zhanyuan Zhang
• Publication: Flores et al Transgenic Res. 2008 Oct;17(5):839-50. doi: 10.1007/s11248-008-9167-6. Epub 2008 Feb 7.

Backbone

• Vector backbone: pPZP201
• Backbone size w/o insert (bp): 7132
• Total vector size (bp): 11499
• Modifications to backbone: bar and GUS genes cassettes were inserted to the multiple cloning sites
• Vector type: Plant Expression
• Selectable markers: aadA

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: 28 C is needed to grow Agrobacterium cells. SmR gene confers resistance to spectinomycin and streptomycin in bacteria
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: bar and GUS cassettes
• Species: bacteria
• Promoter: 35S

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoR I (destroyed during cloning)
• 3′ cloning site: Hind III (not destroyed)
• 5′ sequencing primer: gaagtccagctgccagaaac
• 3′ sequencing primer: agtcgaccgtgtacgtctcc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Discrepancies between Depositor's full sequence and Addgene's QC sequence are not of functional concern.