pMU103
(Plasmid
#73934)
-
PurposeThis is hpRNA construct for gene silencing in soybean seeds. Soybean seed specific promoter, Glycinin gene promoter, is used.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73934 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepPZP201
- Backbone size w/o insert (bp) 7132
- Total vector size (bp) 11499
-
Modifications to backbonebar and GUS genes cassettes were inserted to the multiple cloning sites
-
Vector typePlant Expression
-
Selectable markersaadA
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructions28 C is needed to grow Agrobacterium cells. SmR gene confers resistance to spectinomycin and streptomycin in bacteria
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namebar and GUS cassettes
-
Speciesbacteria
- Promoter 35S
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR I (destroyed during cloning)
- 3′ cloning site Hind III (not destroyed)
- 5′ sequencing primer gaagtccagctgccagaaac
- 3′ sequencing primer agtcgaccgtgtacgtctcc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Discrepancies between Depositor's full sequence and Addgene's QC sequence are not of functional concern.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMU103 was a gift from Zhanyuan Zhang (Addgene plasmid # 73934 ; http://n2t.net/addgene:73934 ; RRID:Addgene_73934) -
For your References section:
Silencing of GmFAD3 gene by siRNA leads to low alpha-linolenic acids (18:3) of fad3-mutant phenotype in soybean [Glycine max (Merr.)]. Flores T, Karpova O, Su X, Zeng P, Bilyeu K, Sleper DA, Nguyen HT, Zhang ZJ. Transgenic Res. 2008 Oct;17(5):839-50. doi: 10.1007/s11248-008-9167-6. Epub 2008 Feb 7. 10.1007/s11248-008-9167-6 PubMed 18256901