Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #73951)

Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 73951 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Connie Cepko
  • Backbone size w/o insert (bp) 4796
  • Total vector size (bp) 6306
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    sfGFP (superfolder GFP)
  • Species
    H. sapiens (human), M. musculus (mouse), R. norvegicus (rat), Synthetic
  • Insert Size (bp)
  • Promoter Chicken beta actin
  • Tag / Fusion Protein
    • A residual PQR peptide wii be left at the C-terminal of GFP

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCAACGTGCTGGTTATTGTG
  • 3′ sequencing primer TGAAGTGGTGGTTGTTCACG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Alt name
  • Species
    H. sapiens (human), M. musculus (mouse), R. norvegicus (rat)
  • Insert Size (bp)
  • Promoter Chicken beta actin (shared with sfGFP as in a bicistronic element)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTTGCCCGACAACCACTACT
  • 3′ sequencing primer CCCATAATTTTTGGCAGAGG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-GFP-PQRv3-RFP was a gift from Brian Chen (Addgene plasmid # 73951 ; ; RRID:Addgene_73951)
  • For your References section:

    Quantification of Protein Levels in Single Living Cells. Lo CA, Kays I, Emran F, Lin TJ, Cvetkovska V, Chen BE. Cell Rep. 2015 Dec 22;13(11):2634-44. doi: 10.1016/j.celrep.2015.11.048. Epub 2015 Dec 10. 10.1016/j.celrep.2015.11.048 PubMed 26686644