pCAG-GFP-PQRv3-RFP
(Plasmid #73951)

• Purpose: Protein Quantitation Reporter (PQR) to quantify a protein of interest in mammalian cells.
• Depositing Lab: Brian Chen
• Publication: Lo et al Cell Rep. 2015 Dec 22;13(11):2634-44. doi: 10.1016/j.celrep.2015.11.048. Epub 2015 Dec 10.

Backbone

• Vector backbone: pCAG
• Backbone manufacturer: Connie Cepko
• Backbone size w/o insert (bp): 4796
• Total vector size (bp): 6306
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: sfGFP (superfolder GFP)
• Species: H. sapiens (human), M. musculus (mouse), R. norvegicus (rat), Synthetic
• Insert Size (bp): 717
• Promoter: Chicken beta actin
• Tag / Fusion Protein:
  • A residual PQR peptide wii be left at the C-terminal of GFP

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCAACGTGCTGGTTATTGTG
• 3′ sequencing primer: TGAAGTGGTGGTTGTTCACG

Gene/Insert 2

• Gene/Insert name: RFP
• Alt name: TagRFP-T
• Species: H. sapiens (human), M. musculus (mouse), R. norvegicus (rat)
• Insert Size (bp): 732
• Promoter: Chicken beta actin (shared with sfGFP as in a bicistronic element)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTTGCCCGACAACCACTACT
• 3′ sequencing primer: CCCATAATTTTTGGCAGAGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: all genes were synthesized

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry