Modified Shipping Schedule: Addgene will be closed November 23rd & 24th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 20 - 24. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLEX-MCS-ASC-GFP
(Plasmid #73957)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 73957 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLEX-Myc
  • Backbone size w/o insert (bp) 11088
  • Total vector size (bp) 13200
  • Modifications to backbone
    A MCS was inserted into the BamHI and XhoI sites (the BamH1 site was destroyed) as indicated in the attached map
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PYD and CARD domain containing, PYCARD
  • Alt name
    ASC
  • Alt name
    TMS-1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2000
  • GenBank ID
    NM_013258.4
  • Entrez Gene
    PYCARD (a.k.a. ASC, CARD5, TMS, TMS-1, TMS1)
  • Promoter CMV IE
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Spe1 (destroyed during cloning)
  • 3′ cloning site Not1 (not destroyed)
  • 5′ sequencing primer CMV iE FwD (CGCAAATGGGCGGTAGGCGTG)
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLEX-MCS-ASC-GFP was a gift from Christian Stehlik (Addgene plasmid # 73957)
  • For your References section:

    The PYRIN Domain-only Protein POP1 Inhibits Inflammasome Assembly and Ameliorates Inflammatory Disease. de Almeida L, Khare S, Misharin AV, Patel R, Ratsimandresy RA, Wallin MC, Perlman H, Greaves DR, Hoffman HM, Dorfleutner A, Stehlik C. Immunity. 2015 Aug 18;43(2):264-76. doi: 10.1016/j.immuni.2015.07.018. Epub 2015 Aug 11. 10.1016/j.immuni.2015.07.018 PubMed 26275995