Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #74050)


Item Catalog # Description Quantity Price (USD)
Plasmid 74050 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 7200
  • Total vector size (bp) 9851
  • Modifications to backbone
    added SV40 ori
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
    human NFATc2, isoform C
  • Alt name
  • Alt name
    nuclear factor of activated T-cells 2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    silent mutation A1723C in the sequence of NM_173091.3 (A1503C position in ORF of the vector)
  • GenBank ID
    NM_173091.3 Gene-ID: 4773
  • Entrez Gene
    NFATC2 (a.k.a. NFAT1, NFATP)
  • Promoter pMSCV-LTRs
  • Tag / Fusion Protein
    • no tag

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacII (not destroyed)
  • 3′ cloning site Sgf1 (not destroyed)
  • 5′ sequencing primer CGTTCGACCCCGCCTCGATCC
  • 3′ sequencing primer AGCTTGATATCGAATTCCG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Plasmid may be particularly prone to recombination; please screen multiple colonies by restriction analysis before selecting a clone to perform downstream experiments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMIG-hNFATc2 was a gift from Ria Baumgrass (Addgene plasmid # 74050 ; ; RRID:Addgene_74050)
  • For your References section:

    Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. Gabriel CH, Gross F, Karl M, Stephanowitz H, Hennig AF, Weber M, Gryzik S, Bachmann I, Hecklau K, Wienands J, Schuchhardt J, Herzel H, Radbruch A, Krause E, Baumgrass R. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326. 10.1074/jbc.M116.739326 PubMed 27637333