This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pMOD8A-iRGR-r11
(Plasmid #74369)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 74369 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMOD8
  • Backbone manufacturer
    Klavins Lab
  • Backbone size w/o insert (bp) 4629
  • Total vector size (bp) 6634
  • Vector type
    Yeast Expression, CRISPR, Synthetic Biology
  • Selectable markers
    HIS3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RGR-r11
  • gRNA/shRNA sequence
    r11
  • Species
    Synthetic
  • Promoter AHD1

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ccttaaccagattcgaaaagcggc
  • 3′ sequencing primer cggggcggggttattacgacat
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2016/03/02/041871 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMOD8A-iRGR-r11 was a gift from Eric Klavins (Addgene plasmid # 74369 ; http://n2t.net/addgene:74369 ; RRID:Addgene_74369)
  • For your References section:

    Robust digital logic circuits in eukaryotic cells with CRISPR/dCas9 NOR gates. Gander MW, Vrana JD, Voje Jr WE, Carothers JM, Klavins E. bioRxiv 041871 10.1101/041871