Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBLO1806_Cas9_2xNLS_human
(Plasmid #74493)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 74493 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    px330
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9
  • Species
    H. sapiens (human), Synthetic
  • Tag / Fusion Protein
    • t2a mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site bsaI (destroyed during cloning)
  • 3′ cloning site bsai (destroyed during cloning)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATTCCT
  • 3′ sequencing primer ggctgctaaagcgcatgct
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    modified pX330 inserts

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBLO1806_Cas9_2xNLS_human was a gift from David Savage (Addgene plasmid # 74493 ; http://n2t.net/addgene:74493 ; RRID:Addgene_74493)
  • For your References section:

    Profiling of engineering hotspots identifies an allosteric CRISPR-Cas9 switch. Oakes BL, Nadler DC, Flamholz A, Fellmann C, Staahl BT, Doudna JA, Savage DF. Nat Biotechnol. 2016 May 2. doi: 10.1038/nbt.3528. 10.1038/nbt.3528 PubMed 27136077