pJJR50
(Plasmid
#75026)
-
PurposeU6 promoter driven flipped + extended sgRNA expression vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 75026 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBluescript
-
Backbone manufacturerStratagene
- Total vector size (bp) 2958
-
Modifications to backboneInserted promoter + sgRNA into EcoRV
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameguide RNA, flipped and extended version
-
Alt namesgRNA
-
gRNA/shRNA sequenceGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTT
-
SpeciesC. elegans (nematode), Synthetic
-
Insert Size (bp)80
- Promoter R07E5.16 (U6)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (destroyed during cloning)
- 3′ cloning site EcoRV (destroyed during cloning)
- 5′ sequencing primer tgtaaaacgacggccagt
- 3′ sequencing primer catggtcatagctgtttcctg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This vector is for cloning an sgRNA. Sequence is inserted as an annealed oligonucleotide linker into vector digested with BbsI.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJJR50 was a gift from Mike Boxem (Addgene plasmid # 75026 ; http://n2t.net/addgene:75026 ; RRID:Addgene_75026) -
For your References section:
A tissue-specific protein purification approach in Caenorhabditis elegans identifies novel interaction partners of DLG-1/Discs large. Waaijers S, Munoz J, Berends C, Ramalho JJ, Goerdayal SS, Low TY, Zoumaro-Djayoon AD, Hoffmann M, Koorman T, Tas RP, Harterink M, Seelk S, Kerver J, Hoogenraad CC, Bossinger O, Tursun B, van den Heuvel S, Heck AJ, Boxem M. BMC Biol. 2016 Aug 9;14:66. doi: 10.1186/s12915-016-0286-x. 10.1186/s12915-016-0286-x PubMed 27506200