pAAV CD68-EGFP
(Plasmid #75034)

• Purpose: Expression of EGFP using the CD68 promoter.
• Depositing Lab: Bryan Roth
• Publication: Grace et al Proc Natl Acad Sci U S A. 2016 Jun 14;113(24):E3441-50. doi: 10.1073/pnas.1602070113. Epub 2016 May 31.

Backbone

• Vector backbone: AAV
• Backbone size w/o insert (bp): 4023
• Total vector size (bp): 6070
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EGFP
• Species: Synthetic
• Insert Size (bp): 1000
• Promoter: CD68

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: unknown (unknown if destroyed)
• 3′ cloning site: unknown (unknown if destroyed)
• 5′ sequencing primer: CGTCGCCGTCCAGCTCGACCA
• 3′ sequencing primer: caacgggccacaactcctc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.