pMSCV-hygro-TTF-1 Q210K-Y214M
(Plasmid #75084)

• Purpose: retroviral vector containing human TTF-1 mutant cDNA
• Depositing Lab: David Mu
• Publication: Runkle et al J Biol Chem. 2012 Aug 17;287(34):28790-801. doi: 10.1074/jbc.M112.367987. Epub 2012 Jul 2.

Backbone

• Vector backbone: pMSCV-hygro
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: TTF-1
• Species: H. sapiens (human)
• Mutation: Q210K and Y214M mutations in homeodomain
• Entrez Gene: NKX2-1 (a.k.a. BCH, BHC, NK-2, NKX2.1, NKX2A, NMTC1, T/EBP, TEBP, TITF1, TTF-1, TTF1)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xho I (not destroyed)
• 3′ cloning site: Xho I (not destroyed)
• 5′ sequencing primer: CCCTTGAACCTCCTCGTTCGACC
• 3′ sequencing primer: GAGACGTGCTACTTCCATTTGTC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid contains a mutant of TTF-1. The two mutated amino acid residues are in the homeodomain of TTF-1