pLC-RFP657-CASP8
(Plasmid
#75164)
-
PurposeLentiCRISPR-RFP657 with sgRNA targeting human Caspase-8
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 75164 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonelentiCRISPRv1
- Total vector size (bp) 11696
-
Modifications to backboneSwap puromycin resistance for tagBFP
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCASP8 sgRNA
-
Alt nameCaspase-8
-
gRNA/shRNA sequenceGCCTGGACTACATTCCGCAA
-
SpeciesH. sapiens (human)
-
GenBank IDNG_007497.1
-
Entrez GeneCASP8 (a.k.a. ALPS2B, CAP4, Casp-8, FLICE, MACH, MCH5)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (Esp3I) (destroyed during cloning)
- 3′ cloning site BsmBI (Esp3I) (destroyed during cloning)
- 5′ sequencing primer GACTATCATATGCTTACCGT
- 3′ sequencing primer AAACTTGCGGAATGTAGTCCAGGCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLC-RFP657-CASP8 was a gift from Beat Bornhauser (Addgene plasmid # 75164 ; http://n2t.net/addgene:75164 ; RRID:Addgene_75164) -
For your References section:
Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. McComb S, Aguade-Gorgorio J, Harder L, Marovca B, Cario G, Eckert C, Schrappe M, Stanulla M, von Stackelberg A, Bourquin JP, Bornhauser BC. Sci Transl Med. 2016 May 18;8(339):339ra70. doi: 10.1126/scitranslmed.aad2986. 10.1126/scitranslmed.aad2986 PubMed 27194728