pMSCV40-EF1a-hBCL10-SO
(Plasmid #75256)

• Purpose: retroviral expression vector for expression of StrepOne-Tagged human BCL10
• Depositing Lab: Ria Baumgrass
• Publication: Gabriel et al J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.

Backbone

• Vector backbone: pMSCV-IRES-GFP (pMIG)
• Backbone size w/o insert (bp): 8400
• Total vector size (bp): 9163
• Modifications to backbone: Added EF1a promoter prior to insert, added SV40-ori
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: GFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Bcl10
• Alt name: BCL-10, CIPER
• Alt name: B-cell CLL/lymphoma 10
• Species: H. sapiens (human)
• GenBank ID: 8915 (gene-id) NM_003921.4
• Entrez Gene: BCL10 (a.k.a. CARMEN, CIPER, CLAP, IMD37, c-E10, mE10)
• Promoter: pMSCV-LTRs, EF1a
• Tag / Fusion Protein:
  • StrepOne Tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SwaI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: AGCTTGATATCGAATTCCG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

EF1a promoter ensures enhanced transgene transcription in some cells, but significantly reduces virus titer. This may result in less transduced cells, which produce high amounts of transgene, though, and can be sorted via GFP.