pYFP-RPB1aAmr
(Plasmid #75284)

• Purpose: Expresses alpha-amanitin resistant EYFP tagged POLR2A in mammalian cells
• Depositing Labs: Xavier Darzacq, Robert Singer
• Publication: Darzacq et al Nat Struct Mol Biol. 2007 Sep;14(9):796-806. Epub 2007 Aug 5.

Backbone

• Vector backbone: pEYFP-C1
• Backbone manufacturer: BD Biosciences Clontech
• Backbone size w/o insert (bp): 4731
• Total vector size (bp): 10646
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: POLR2A
• Alt name: RPB1
• Species: H. sapiens (human)
• Insert Size (bp): 5911
• Mutation: N792D alpha-amanitin–resistant
• GenBank ID: NM_000937.4
• Entrez Gene: POLR2A (a.k.a. NEDHIB, POLR2, POLRA, RPB1, RPBh1, RPO2, RPOL2, RpIILS, hRPB220, hsRPB1)
• Promoter: CMV
• Tag / Fusion Protein:
  • EYFP (N terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CMV Forward CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: pX-C1 REVseq TATGTTTCAGGTTCAGGGGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry