190_SMAD4 in pmiRGlo
(Plasmid
#78128)
-
Purposeluciferase reporter for miRNA activity
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 78128 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepmiRGlo
-
Backbone manufacturerPromega
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSMAD4
-
SpeciesH. sapiens (human)
-
Mutation3'UTR containing miRNA binding sites
-
Entrez GeneSMAD4 (a.k.a. DPC4, JIP, MADH4, MYHRS)
- Promoter PGK
-
Tag
/ Fusion Protein
- luciferase (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer Fluc-F1 (AGAAGCTGCGCGGTGGTGTTGTG)
- 3′ sequencing primer T7terminal (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
190_SMAD4 in pmiRGlo was a gift from Heidi Schwarzenbach (Addgene plasmid # 78128 ; http://n2t.net/addgene:78128 ; RRID:Addgene_78128) -
For your References section:
Increased serum levels of circulating exosomal microRNA-373 in receptor-negative breast cancer patients. Eichelser C, Stuckrath I, Muller V, Milde-Langosch K, Wikman H, Pantel K, Schwarzenbach H. Oncotarget. 2014 Oct 30;5(20):9650-63. 10.18632/oncotarget.2520 PubMed 25333260