psiCHECK2-miR-34 WT
(Plasmid
#78258)
-
PurposepsiCHECK2 dual luciferase reporter harboring a fully complementary miR-34 target element, cloned into the XhoI/NotI restriction sites, the 3'UTR of the Renilla Luciferase gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 78258 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepsiCHECK-2
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 6273
- Total vector size (bp) 6302
-
Vector typeMammalian Expression, Luciferase ; microRNA activity
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namefully complimentary miR-34 target site
-
SpeciesSynthetic
-
Insert Size (bp)29
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGTGCTGAAGAACGAGCAGT
- 3′ sequencing primer CAAACCCCCGCCTCCACGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note there is a single nucleotide mismatch between the published miR34 sequence and Addgene's quality control sequence. This mismatch does not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
psiCHECK2-miR-34 WT was a gift from Joanne Weidhaas (Addgene plasmid # 78258 ; http://n2t.net/addgene:78258 ; RRID:Addgene_78258) -
For your References section:
miR-34 activity is modulated through 5'-end phosphorylation in response to DNA damage. Salzman DW, Nakamura K, Nallur S, Dookwah MT, Metheetrairut C, Slack FJ, Weidhaas JB. Nat Commun. 2016 Mar 21;7:10954. doi: 10.1038/ncomms10954. 10.1038/ncomms10954 PubMed 26996824