This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #78289)

Item Catalog # Description Quantity Price (USD)
Plasmid 78289 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

  • Vector backbone
    PiggyBac transformation vector pB
  • Backbone size w/o insert (bp) 6652
  • Total vector size (bp) 7739
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

  • Gene/Insert name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • GenBank ID
    NM_000801 AB971579
  • Entrez Gene
    FKBP1A (a.k.a. FKBP-12, FKBP-1A, FKBP1, FKBP12, PKC12, PKCI2, PPIASE)
  • Promoter pCAG
  • Tag / Fusion Protein
    • MLALKLAGLDI (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site HpaI (not destroyed)
  • 5′ sequencing primer YM213--5' atgccttcttctttttcctacagct
  • 3′ sequencing primer YM215--5' gatgagtttggacaaaccacaact
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AgDD was a gift from Thomas Wandless (Addgene plasmid # 78289)
  • For your References section:

    A method to rapidly create protein aggregates in living cells. Miyazaki Y, Mizumoto K, Dey G, Kudo T, Perrino J, Chen LC, Meyer T, Wandless TJ. Nat Commun. 2016 May 27;7:11689. doi: 10.1038/ncomms11689. 10.1038/ncomms11689 PubMed 27229621