pDECKO_mCherry
(Plasmid #78534)

• Purpose: (Empty Backbone) Backbone to clone single or paired sgRNAs
• Depositing Labs: Roderic Guigo, Rory Johnson
• Publication: Pulido-Quetglas et al PLoS Comput Biol. 2017 Mar 2;13(3):e1005341. doi: 10.1371/journal.pcbi.1005341. eCollection 2017 Mar.

Backbone

• Vector backbone: Lentiguide-puro
• Backbone manufacturer: Addgene 52963
• Backbone size (bp): 10182
• Modifications to backbone: Added mCherry (711 bp).
• Vector type: Mammalian Expression, Lentiviral
• Promoter: U6 (for expressing sgRNA)
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTACAAAATACGTGACGTAG
• 3′ sequencing primer: ATGTCTACTATTCTTTCCCC

Resource Information

• Supplemental Documents:
  • pDECKO_mCherry
• A portion of this plasmid was derived from a plasmid made by: mCherry was amplified from plasmid Addgene ref. 52963
• Articles Citing this Plasmid:
  • 11 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

A cloning protocol can be found in the supplemental materials of the associated publication.