-
Purposeimage recycling of VGAT in live neurons
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 78578 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAGGS E/S
- Backbone size w/o insert (bp) 4790
- Total vector size (bp) 7691
-
Modifications to backboneSphI site in the MCS removed because it contains an ATG
-
Vector typeMammalian Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namevGAT-pHluorin C-term
-
Alt nameVGAT-pH
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)3112
-
GenBank IDAF030253.1 AY533296.1
-
Entrez GeneSlc32a1 (a.k.a. Vgat, Viaat)
- Promoter chicken actin
-
Tag
/ Fusion Protein
- superecliptic pHluorin (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TAGCTCGAGGTACCGATATC
- 3′ sequencing primer CCTGAGGAGTGAATTGAGCTC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byOriginal clone of rat VGAT was from Dr. Robert H. Edwards, University of California San Francisco
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
vGAT-pH pcaggs SE was a gift from Susan Voglmaier (Addgene plasmid # 78578 ; http://n2t.net/addgene:78578 ; RRID:Addgene_78578) -
For your References section:
Sorting of the vesicular GABA transporter to functional vesicle pools by an atypical dileucine-like motif. Santos MS, Park CK, Foss SM, Li H, Voglmaier SM. J Neurosci. 2013 Jun 26;33(26):10634-46. doi: 10.1523/JNEUROSCI.0329-13.2013. 10.1523/JNEUROSCI.0329-13.2013 PubMed 23804087
Map uploaded by the depositor.