vGAT-pH pcaggs SE
(Plasmid #78578)

• Purpose: image recycling of VGAT in live neurons
• Depositing Lab: Susan Voglmaier
• Publication: Santos et al J Neurosci. 2013 Jun 26;33(26):10634-46. doi: 10.1523/JNEUROSCI.0329-13.2013.

Backbone

• Vector backbone: pCAGGS E/S
• Backbone size w/o insert (bp): 4790
• Total vector size (bp): 7691
• Modifications to backbone: SphI site in the MCS removed because it contains an ATG
• Vector type: Mammalian Expression
• Selectable markers: Gentamicin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: vGAT-pHluorin C-term
• Alt name: VGAT-pH
• Species: R. norvegicus (rat)
• Insert Size (bp): 3112
• GenBank ID: AF030253.1 AY533296.1
• Entrez Gene: Slc32a1 (a.k.a. Vgat, Viaat)
• Promoter: chicken actin
• Tag / Fusion Protein:
  • superecliptic pHluorin (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TAGCTCGAGGTACCGATATC
• 3′ sequencing primer: CCTGAGGAGTGAATTGAGCTC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Original clone of rat VGAT was from Dr. Robert H. Edwards, University of California San Francisco
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry