Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pZac2.1 CMV173-SaCas9-U6-SaDMDR7-U6-SaDMDL2
(Plasmid #78606)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 78606 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CMV173-SaCas9-U6-SaDMDR7-U6-SaDMDL2
  • Species
    Synthetic
  • Insert Size (bp)
    4357
  • Promoter 173CMV, U6
  • Tag / Fusion Protein
    • HA tag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAATTCGAGCTCGGTACCC
  • 3′ sequencing primer TCGACTCTAGAGGATCCCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    SaCas9 from Feng Zhang at Broad Institute.
  • Terms and Licenses

Depositor Comments

gRNA targeting sequences:
CAGTAATGTGTCATACCTTC;
ATATAATAGAAATTATTCAT

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZac2.1 CMV173-SaCas9-U6-SaDMDR7-U6-SaDMDL2 was a gift from Amy Wagers (Addgene plasmid # 78606 ; http://n2t.net/addgene:78606 ; RRID:Addgene_78606)
  • For your References section:

    In vivo gene editing in dystrophic mouse muscle and muscle stem cells. Tabebordbar M, Zhu K, Cheng JK, Chew WL, Widrick JJ, Yan WX, Maesner C, Wu EY, Xiao R, Ran FA, Cong L, Zhang F, Vandenberghe LH, Church GM, Wagers AJ. Science. 2016 Jan 22;351(6271):407-11. doi: 10.1126/science.aad5177. Epub 2015 Dec 31. 10.1126/science.aad5177 PubMed 26721686